Mouse SIGLEC5 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Mouse

NCBI Ref Seq

NM_145581.1

RefSeq ORF Size

1710bp

Gene Synonym

Siglecf, mSiglec-F

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse sialic acid binding Ig-like lectin 5 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

SIGLEC5 contains 2 Ig-like C2-type (immunoglobulin-like) domains and 1 Ig-like V-type (immunoglobulin-like) domain. It belongs to the immunoglobulin superfamily and SIGLEC (sialic acid binding Ig-like lectin) family. SIGLEC5 is expressed by monocytic/myeloid lineage cells. It is found at high levels in peripheral blood leukocytes, spleen, bone marrow and at lower levels in lymph node, lung, appendix, placenta, pancreas and thymus. It is also expressed by monocytes and neutrophils but absent from leukemic cell lines representing early stages of myelomonocytic differentiation. SIGLEC5 is a putative adhesion molecule that mediates sialic-acid dependent binding to cells. It binds equally to alpha-2,3-linked and alpha-2,6-linked sialic acid. The sialic acid recognition site may be masked by cis interactions with sialic acids on the same cell surface.

References

Angata T, et al. (2006) Discovery of Siglec-14, a novel sialic acid receptor undergoing concerted evolution with Siglec-5 in primates. FASEB J. 20(12):1964-73.

Avril T, et al. (2005) Siglec-5 (CD170) can mediate inhibitory signaling in the absence of immunoreceptor tyrosine-based inhibitory motif phosphorylation. J Biol Chem. 280(20):19843-51.

Erickson-Miller CL, et al. (2003) Characterization of Siglec-5 (CD170) expression and functional activity of anti-Siglec-5 antibodies on human phagocytes. Exp Hematol. 31(5):382-8.

Catalog Number:MGH050-CY