Mouse SGK3/SGKL Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Mouse

NCBI Ref Seq

NM_177547.3

RefSeq ORF Size

1491bp

Gene Synonym

fy; fz; Cisk; 2510015P22Rik; A330005P07Rik

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse serum/glucocorticoid regulated kinase 3 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Serine / threonine-protein kinase Sgk3, also known as Serum / glucocorticoid-regulated kinase 3, Serum / glucocorticoid-regulated kinase-like and SGK3, is a cytoplasmic vesicle protein which belongs to the protein kinase superfamily and AGC Ser/Thr protein kinase family. SGK3 contains one AGC-kinase C-terminal domain, one protein kinase domain and one PX (phox homology) domain. Two specific sites of SGK3, one in the kinase domain (Thr-320) and the other in the C-terminal regulatory region (Ser-486), is needed to be phosphorylated for its full activation. SGK3 is expressed in most tissues with highest levels in pancreas, kidney liver, heart and brain and lower levels in lung, placenta and skeletal muscle. SGK3 is involved in the activation of potassium channels. It mediates cell IL-3-dependent survival signals. SGK3 participates in the regulation of HERG by increasing HERG protein abundance in the plasma membrane and may thus modify the duration of the cardiac action potential. SGK3 is also a very important and characteristic molecule that plays a critical role in both hair follicle morphogenesis and hair cycling.

References

Friedrich,B. et al., 2003, Pflugers Arch. 445 (6):693-6.

Shojaiefard,M. et al., 2005, Biochem Biophys Res Commun. 334 (3): 742 - 6.

Maier,G. et al., 2006, Cell Physiol Biochem. 18 (4-5):177-86.

Okada,T. et al., 2006, Am J Pathol. 168 (4):1119-33.

Mauro,T.M. et al., 2009, FASEB J 23 (9):3193-202.

Catalog Number:MGH007-CY