Mouse SGK3/SGKL Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:MGH007-CF

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1491bp
Gene Synonym
fy; fz; Cisk; 2510015P22Rik; A330005P07Rik
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse serum/glucocorticoid regulated kinase 3 Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Serine / threonine-protein kinase Sgk3, also known as Serum / glucocorticoid-regulated kinase 3, Serum / glucocorticoid-regulated kinase-like and SGK3, is a cytoplasmic vesicle protein which belongs to the protein kinase superfamily and AGC Ser/Thr protein kinase family. SGK3 contains one AGC-kinase C-terminal domain, one protein kinase domain and one PX (phox homology) domain. Two specific sites of SGK3, one in the kinase domain (Thr-320) and the other in the C-terminal regulatory region (Ser-486), is needed to be phosphorylated for its full activation. SGK3 is expressed in most tissues with highest levels in pancreas, kidney liver, heart and brain and lower levels in lung, placenta and skeletal muscle. SGK3 is involved in the activation of potassium channels. It mediates cell IL-3-dependent survival signals. SGK3 participates in the regulation of HERG by increasing HERG protein abundance in the plasma membrane and may thus modify the duration of the cardiac action potential. SGK3 is also a very important and characteristic molecule that plays a critical role in both hair follicle morphogenesis and hair cycling.
References
  • Friedrich,B. et al., 2003, Pflugers Arch. 445 (6):693-6.
  • Shojaiefard,M. et al., 2005, Biochem Biophys Res Commun. 334 (3): 742 - 6.
  • Maier,G. et al., 2006, Cell Physiol Biochem. 18 (4-5):177-86.
  • Okada,T. et al., 2006, Am J Pathol. 168 (4):1119-33.
  • Mauro,T.M. et al., 2009, FASEB J  23 (9):3193-202.
  • TOP