Mouse SFRP2 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:MGG993-NM

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
888bp
Gene Synonym
Sdf5, AI851596
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse secreted frizzled-related protein 2 Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
The Secreted frizzled-related protein (SFRP) family consists of five secreted glycoproteins in humans (SFRP1~5) that act as extracellular signaling ligands. Each SFRP is approximately 300 amino acids in length and contains a cysteine-rich domain (CRD) that shares 30-50% sequence homology with the CRD of Frizzled (Fz) receptors, a putative signal sequence, and a conserved hydrophilic carboxy-terminal domain. SFRPs are able to bind Wnt proteins and Fz receptors in the extracellular compartment. The interaction between SFRPs and Wnt proteins prevents the latter from binding the Fz receptors. The Wnt pathway plays a key role in embryonic development, cell differentiation and cell proliferation. sFRP2 is a member of the SFRP family acting as soluble modulators of Wnt signaling and contains a cysteine-rich domain homologous to the putative Wnt-binding site of Frizzled proteins called FZ domain and a NTR domain.sFRP2 inhibites hypoxia induced endothelial cell apoptosis and increases endothelial cell migration. It prevents mesoderm specification and maintains the cells in the undifferentiated state. SFRP2 is also a novel stimulator of angiogenesis that stimulates angiogenesis via a calcineurin/NFAT pathway, thus is regarded as a favorable target for the inhibition of angiogenesis in solid tumors. Mouse sFRP2 is highly expressed in the eye and is also detected in heart and lung at low level.
References
TOP