Mouse SFRP2 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Catalog Number:MGG993-CY

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
888bp
Gene Synonym
Sdf5, AI851596
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse secreted frizzled-related protein 2 Gene ORF cDNA clone expression plasmid,C terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
The Secreted frizzled-related protein (SFRP) family consists of five secreted glycoproteins in humans (SFRP1~5) that act as extracellular signaling ligands. Each SFRP is approximately 300 amino acids in length and contains a cysteine-rich domain (CRD) that shares 30-50% sequence homology with the CRD of Frizzled (Fz) receptors, a putative signal sequence, and a conserved hydrophilic carboxy-terminal domain. SFRPs are able to bind Wnt proteins and Fz receptors in the extracellular compartment. The interaction between SFRPs and Wnt proteins prevents the latter from binding the Fz receptors. The Wnt pathway plays a key role in embryonic development, cell differentiation and cell proliferation. sFRP2 is a member of the SFRP family acting as soluble modulators of Wnt signaling and contains a cysteine-rich domain homologous to the putative Wnt-binding site of Frizzled proteins called FZ domain and a NTR domain.sFRP2 inhibites hypoxia induced endothelial cell apoptosis and increases endothelial cell migration. It prevents mesoderm specification and maintains the cells in the undifferentiated state. SFRP2 is also a novel stimulator of angiogenesis that stimulates angiogenesis via a calcineurin/NFAT pathway, thus is regarded as a favorable target for the inhibition of angiogenesis in solid tumors. Mouse sFRP2 is highly expressed in the eye and is also detected in heart and lung at low level.
References
TOP