Human SerpinB6 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Human

NCBI Ref Seq

NM_004568.5

RefSeq ORF Size

1131bp

Gene Synonym

CAP, PI6, PTI, PI-6, SPI3, DFNB91, MSTP057

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human serpin peptidase inhibitor, clade B (ovalbumin), member 6 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

SerpinB6, also known as Cytoplasmic antiproteinase, Peptidase inhibitor 6, Placental thrombin inhibitor, SERPINB6 and PI-6, is a cytoplasm protein which belongs to the serpin family and Ov-serpin subfamily. SerpinB6 / PI-6 is an inhibitor of cathepsin G, kallikrein-8 and thrombin. It may play an important role in the inner ear in the protection against leakage of lysosomal content during stress and loss of this protection results in cell death and sensorineural hearing loss. SerpinB6 / PI-6 is expressed in keratinocytes (at protein level). It is also found in placenta, cardiac muscle, lung, liver, kidney and pancreas. SerpinB6 / PI-6 is expressed in the inner ear hair cells. It expressed abundantly by normal mast cells in different tissues and by mast cells in mastocytoma lesions. SerpinB6 / PI-6 may be involved in the regulation of serine proteinases present in the brain or extravasated from the blood. Defects in SerpinB6 are the cause of deafness autosomal recessive type 91 which is a form of non-syndromic deafness characterized by progressive and age-dependent sensorineural hearing loss. Vestibular function is normal.

References

Morgenstern KA. et al.,1994, Biochemistry. 33: 3432-41.

Strik MC. et al., 2004, Blood. 103: 2710-7.

Scott FL. et al., 2007, J Biochem. 142: 435-42.

Burkard TR. et al., 2011, BMC Syst Biol. 5:17.

Catalog Number:MGG959-CY