Human SerpinB6 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Human

NCBI Ref Seq

NM_004568.5

RefSeq ORF Size

1131bp

Gene Synonym

CAP, PI6, PTI, PI-6, SPI3, DFNB91, MSTP057

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human serpin peptidase inhibitor, clade B (ovalbumin), member 6 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

SerpinB6, also known as Cytoplasmic antiproteinase, Peptidase inhibitor 6, Placental thrombin inhibitor, SERPINB6 and PI-6, is a cytoplasm protein which belongs to the serpin family and Ov-serpin subfamily. SerpinB6 / PI-6 is an inhibitor of cathepsin G, kallikrein-8 and thrombin. It may play an important role in the inner ear in the protection against leakage of lysosomal content during stress and loss of this protection results in cell death and sensorineural hearing loss. SerpinB6 / PI-6 is expressed in keratinocytes (at protein level). It is also found in placenta, cardiac muscle, lung, liver, kidney and pancreas. SerpinB6 / PI-6 is expressed in the inner ear hair cells. It expressed abundantly by normal mast cells in different tissues and by mast cells in mastocytoma lesions. SerpinB6 / PI-6 may be involved in the regulation of serine proteinases present in the brain or extravasated from the blood. Defects in SerpinB6 are the cause of deafness autosomal recessive type 91 which is a form of non-syndromic deafness characterized by progressive and age-dependent sensorineural hearing loss. Vestibular function is normal.

References

Morgenstern KA. et al.,1994, Biochemistry. 33: 3432-41.

Strik MC. et al., 2004, Blood. 103: 2710-7.

Scott FL. et al., 2007, J Biochem. 142: 435-42.

Burkard TR. et al., 2011, BMC Syst Biol. 5:17.

Catalog Number:MGG959-CM