Mouse SerpinB10 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Gene

Species

Mouse

NCBI Ref Seq

NM_198028.2

RefSeq ORF Size

1194bp

Gene Synonym

BB233602, 9830131G07, Serpinb10

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 10 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Serpins are the largest and most diverse family of serine protease inhibitors which are involved in a number of fundamental biological processes such as blood coagulation, complement activation, fibrinolysis, angiogenesis, inflammation and tumor suppression and are expressed in a cell-specific manner. Serpins are a group of proteins with similar structures that were first identified as a set of proteins able to inhibit proteases. The acronym serpin was originally coined because many serpins inhibit chymotrypsin-like serine proteases (serine protease inhibitors). Over 1000 serpins have been identified.
Mouse SerpinB10, also known as Peptidase inhibitor 10, PI-10, Bomapin and SERPINB10, is a nucleus and cytoplasm protein which belongs to the serpin family and Ov-serpin subfamily. SerpinB10 is expressed specifically in the bone marrow. SerpinB10 is a protease inhibitor that may play a role in the regulation of protease activities during hematopoiesis and apoptosis induced by TNF. SerpinB10 is a redox-sensitive nuclear serpin that augments proliferation or apoptosis of leukaemia cells, depending on growth factors availability. SerpinB10 may regulate protease activities in the cytoplasm and in the nucleus.

References

Riewald M. et al., 1995, J. Biol. Chem. 270: 26754-7.

Forsyth, S. et al., 2003, Genomics 81: 336-45.

Horvath, AJ. et al., 2004, J. Mol. Evol. 59: 488-97.

Steenbakkers PJ. et al., 2008, Mycol. Res. 112 (Pt 8): 999-1006.

Przygodzka, P. et al., 2010, BMC Cell Biol. 11: 30.

Catalog Number:MGG951-NO