Mouse SerpinB10 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:MGG951-CM

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1194bp
Gene Synonym
BB233602, 9830131G07, Serpinb10
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 10 Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Serpins are the largest and most diverse family of serine protease inhibitors which are involved in a number of fundamental biological processes such as blood coagulation, complement activation, fibrinolysis, angiogenesis, inflammation and tumor suppression and are expressed in a cell-specific manner. Serpins are a group of proteins with similar structures that were first identified as a set of proteins able to inhibit proteases. The acronym serpin was originally coined because many serpins inhibit chymotrypsin-like serine proteases (serine protease inhibitors). Over 1000 serpins have been identified.
Mouse SerpinB10, also known as Peptidase inhibitor 10, PI-10, Bomapin and SERPINB10, is a nucleus and cytoplasm protein which belongs to the serpin family and Ov-serpin subfamily. SerpinB10 is expressed specifically in the bone marrow. SerpinB10 is a protease inhibitor that may play a role in the regulation of protease activities during hematopoiesis and apoptosis induced by TNF. SerpinB10 is a redox-sensitive nuclear serpin that augments proliferation or apoptosis of leukaemia cells, depending on growth factors availability. SerpinB10 may regulate protease activities in the cytoplasm and in the nucleus.
References
  • Riewald M. et al., 1995, J. Biol. Chem. 270: 26754-7.
  • Forsyth, S. et al., 2003, Genomics 81: 336-45. 
  • Horvath, AJ. et al., 2004, J. Mol. Evol. 59: 488-97.
  • Steenbakkers PJ. et al., 2008, Mycol. Res. 112 (Pt 8): 999-1006.
  • Przygodzka, P. et al., 2010, BMC Cell Biol. 11: 30. 
  • TOP