Human SerpinA6 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Human

NCBI Ref Seq

NM_001756.3

RefSeq ORF Size

1218bp

Gene Synonym

CBG,

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Corticosteroid-binding globulin (CBG), also known as SerpinA6, is a non-inhibitory member of the serine proteinase inhibitor (serpin) superfamily. It is the high-affinity transport protein for glucocorticoids in vertebrate blood. CBG is specifically cleaved by this protease at a precise site close to its carboxy-terminus. This induces a conformation change and disrupts the binding between glucocorticoids and CBG, and promotes a significant and local release of glucocorticoids (over 90% of them are bound to CBG in human plasma). In this context, CBG directs glucocorticoids to sites of inflammation, and plays in consequence a crucial role in efficient glucocorticoid action in physiology. The SerpinA6 protein is mainly secreted by the liver. This negative acute phase protein regulates free cortisol levels in the blood and distributes cortisol to its target tissues. SerpinA6 deficiency is an extremely rare hereditary disorder characterized by reduced corticosteroid-binding capacity with normal or low plasma corticosteroid-binding globulin concentration, and normal or low basal cortisol levels associated with hypo-/hypertension and muscle fatigue. There are three heritable, human CBG gene mutations that can reduce CBG-cortisol binding affinity and/or reduce circulating CBG levels.

References

Seralini GE. (1991) A new role for corticosteroid binding globulin (CBG), member of SERPIN superfamily. C R Seances Soc Biol Fil. 185(6): 500-9.

Buss C, et al. (2007) Haploinsufficiency of the SERPINA6 gene is associated with severe muscle fatigue: A de novo mutation in corticosteroid-binding globulin deficiency. J Neural Transm. 114(5): 563-9.

Torpy DJ, et al. (2007) Corticosteroid-binding globulin gene polymorphisms: clinical implications and links to idiopathic chronic fatigue disorders. Clin Endocrinol (Oxf). 67(2): 161-7.

Braun BC, et al. (2010) Effect of mutations of the human serpin protein corticosteroid-binding globulin on cortisol-binding, thermal and protease sensitivity. J Steroid Biochem Mol Biol. 120(1): 30-7.

Lin HY, et al. (2010) Molecular and structural basis of steroid hormone binding and release from corticosteroid-binding globulin. Mol Cell Endocrinol. 316(1): 3-12.

Catalog Number:MGG948-CY