Human SerpinA6 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:MGG948-CF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1218bp
Gene Synonym
CBG,
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6 Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Corticosteroid-binding globulin (CBG), also known as SerpinA6, is a non-inhibitory member of the serine proteinase inhibitor (serpin) superfamily. It is the high-affinity transport protein for glucocorticoids in vertebrate blood. CBG is specifically cleaved by this protease at a precise site close to its carboxy-terminus. This induces a conformation change and disrupts the binding between glucocorticoids and CBG, and promotes a significant and local release of glucocorticoids (over 90% of them are bound to CBG in human plasma). In this context, CBG directs glucocorticoids to sites of inflammation, and plays in consequence a crucial role in efficient glucocorticoid action in physiology. The SerpinA6 protein is mainly secreted by the liver. This negative acute phase protein regulates free cortisol levels in the blood and distributes cortisol to its target tissues. SerpinA6 deficiency is an extremely rare hereditary disorder characterized by reduced corticosteroid-binding capacity with normal or low plasma corticosteroid-binding globulin concentration, and normal or low basal cortisol levels associated with hypo-/hypertension and muscle fatigue. There are three heritable, human CBG gene mutations that can reduce CBG-cortisol binding affinity and/or reduce circulating CBG levels.
References
  • Seralini GE. (1991) A new role for corticosteroid binding globulin (CBG), member of SERPIN superfamily. C R Seances Soc Biol Fil. 185(6): 500-9.
  • Buss C, et al. (2007) Haploinsufficiency of the SERPINA6 gene is associated with severe muscle fatigue: A de novo mutation in corticosteroid-binding globulin deficiency. J Neural Transm. 114(5): 563-9.
  • Torpy DJ, et al. (2007) Corticosteroid-binding globulin gene polymorphisms: clinical implications and links to idiopathic chronic fatigue disorders. Clin Endocrinol (Oxf). 67(2): 161-7.
  • Braun BC, et al. (2010) Effect of mutations of the human serpin protein corticosteroid-binding globulin on cortisol-binding, thermal and protease sensitivity. J Steroid Biochem Mol Biol. 120(1): 30-7.
  • Lin HY, et al. (2010) Molecular and structural basis of steroid hormone binding and release from corticosteroid-binding globulin. Mol Cell Endocrinol. 316(1): 3-12.
  • TOP