Mouse Semaphorin 3A/SEMA3A Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Mouse

NCBI Ref Seq

NM_009152.3

RefSeq ORF Size

2319bp

Gene Synonym

SemD, SEMA1, Semad, coll-1, Hsema-I, Sema3a

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Semaphorins are a family of secreted and cell-bound signaling molecules defined by the presence of a common 500 aa Sema domain. They are best characterized in relation to axon guidance during development of the nervous system. The functions of Semaphorins 3A (SEMA3A) are mediated primarily through binding to the Neuropilin-1 (Npn-1) and Plexin-A1 coreceptor complex. Neuropilins lack a signaling-competent cytoplasetmic domain and ensure semaphorin binding, whereas the transmembrane receptor plexin mediates the intracellular response. As the first identified vertebrate semaphorin, SEMA3A functions either as a chemorepulsive agent inhibiting axonal outgrowth, or as a chemoattractive agent stimulating the growth of apical dendrites. In both cases, the protein is vital for normal neuronal pattern development. Its overexpression is associated with schizophrenia which is seen in various human tumor cell lines, and aberrant release is associated with the progression of Alzheimer's disease

References

Giordano,A. et al., 2003, J Neurocytol.32(4):345-352.

Good, P. F. et al., 2005, J. Neurochem.91(3): 716-736.

Gu, C. et al., 2005, Science.307(5707): 265–268.

Chadborn,N.H. et al., 2006, J Cell Sci.119(Pt 5):951-957.

Schmidt,E.F. et al., 2007, Adv Exp Med Biol.600:1-11.

Catalog Number:MGG915-CY