Mouse Semaphorin 3A/SEMA3A Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Mouse

NCBI Ref Seq

NM_009152.3

RefSeq ORF Size

2319bp

Gene Synonym

SemD, SEMA1, Semad, coll-1, Hsema-I, Sema3a

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Semaphorins are a family of secreted and cell-bound signaling molecules defined by the presence of a common 500 aa Sema domain. They are best characterized in relation to axon guidance during development of the nervous system. The functions of Semaphorins 3A (SEMA3A) are mediated primarily through binding to the Neuropilin-1 (Npn-1) and Plexin-A1 coreceptor complex. Neuropilins lack a signaling-competent cytoplasetmic domain and ensure semaphorin binding, whereas the transmembrane receptor plexin mediates the intracellular response. As the first identified vertebrate semaphorin, SEMA3A functions either as a chemorepulsive agent inhibiting axonal outgrowth, or as a chemoattractive agent stimulating the growth of apical dendrites. In both cases, the protein is vital for normal neuronal pattern development. Its overexpression is associated with schizophrenia which is seen in various human tumor cell lines, and aberrant release is associated with the progression of Alzheimer's disease

References

Giordano,A. et al., 2003, J Neurocytol.32(4):345-352.

Good, P. F. et al., 2005, J. Neurochem.91(3): 716-736.

Gu, C. et al., 2005, Science.307(5707): 265–268.

Chadborn,N.H. et al., 2006, J Cell Sci.119(Pt 5):951-957.

Schmidt,E.F. et al., 2007, Adv Exp Med Biol.600:1-11.

Catalog Number:MGG915-CM