Rat Selenoprotein M Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Catalog Number:MGG909-NO

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
438bp
Gene Synonym
Selm
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat selenoprotein M Gene ORF cDNA clone expression plasmid,N terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Selenoprotein M is a selenoprotein, which contains a selenocysteine (Sec) residue at its active site. The selenocysteine M is encoded by the UGA codon that normally signals translation termination. The 3' UTR of selenoprotein genes have a common stem-loop structure, the sec insertion sequence (SECIS), that is necessary for the recognition of UGA as a Sec codon rather than as a stop signal. This gene is expressed in a variety of tissues, and the protein is localized to the perinuclear structures. Selenoprotein M May function as a thiol-disulfide oxidoreductase that participates in disulfide bond formation. This protein is widely expressed and is highly expressed in brain. It is found in Cytoplasm, perinuclear region, Endoplasmic reticulum, Golgi apparatus. Localized to perinuclear structures corresponding to Golgi and endoplasmic reticulum. Experiments results have suggested that selenoprotein M may have an important role in protecting against oxidative damage in the brain and may potentially function in calcium regulation.
References
  • Reeves MA, et al. (2010) The neuroprotective functions of selenoprotein M and its role in cytosolic calcium regulation. Antioxid Redox Signal. 12(7): 809-18.
  • Lu W, et al. (2012) Reproductive function of Selenoprotein M in Chinese mitten crabs (Eriocheir sinesis). Peptides. 34(1): 168-76.
  • Garcia-Triana A, et al. (2010) Expression and silencing of Selenoprotein M (SelM) from the white shrimp Litopenaeus vannamei: effect on peroxidase activity and hydrogen peroxide concentration in gills and hepatopancreas. Comp Biochem Physiol A Mol Integr Physiol. 155(2): 200-4.
  • TOP