Rat Selenoprotein M Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Rat

NCBI Ref Seq

NM_001115013.1

RefSeq ORF Size

438bp

Gene Synonym

Selm

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat selenoprotein M Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Selenoprotein M is a selenoprotein, which contains a selenocysteine (Sec) residue at its active site. The selenocysteine M is encoded by the UGA codon that normally signals translation termination. The 3' UTR of selenoprotein genes have a common stem-loop structure, the sec insertion sequence (SECIS), that is necessary for the recognition of UGA as a Sec codon rather than as a stop signal. This gene is expressed in a variety of tissues, and the protein is localized to the perinuclear structures. Selenoprotein M May function as a thiol-disulfide oxidoreductase that participates in disulfide bond formation. This protein is widely expressed and is highly expressed in brain. It is found in Cytoplasm, perinuclear region, Endoplasmic reticulum, Golgi apparatus. Localized to perinuclear structures corresponding to Golgi and endoplasmic reticulum. Experiments results have suggested that selenoprotein M may have an important role in protecting against oxidative damage in the brain and may potentially function in calcium regulation.

References

Reeves MA, et al. (2010) The neuroprotective functions of selenoprotein M and its role in cytosolic calcium regulation. Antioxid Redox Signal. 12(7): 809-18.

Lu W, et al. (2012) Reproductive function of Selenoprotein M in Chinese mitten crabs (Eriocheir sinesis). Peptides. 34(1): 168-76.

Garcia-Triana A, et al. (2010) Expression and silencing of Selenoprotein M (SelM) from the white shrimp Litopenaeus vannamei: effect on peroxidase activity and hydrogen peroxide concentration in gills and hepatopancreas. Comp Biochem Physiol A Mol Integr Physiol. 155(2): 200-4.

Catalog Number:MGG909-CY