Human RPRD1B Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:MGG707-CM

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
981bp
Gene Synonym
CREPT, NET60, C20orf77, dJ1057B20.2, RPRD1B
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human regulation of nuclear pre-mRNA domain containing 1B Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
RPRD1B, together with RPRD1A, can accompany RNAP II from promoter regions to 3'-untranslated regions during transcription in vivo, predominantly interact with phosphorylated RNAP II, and can reduce CTD S5- and S7-phosphorylated RNAP II at target gene promoters. RNA polymerase II C-terminal domain (CTD) phosphorylation is important for various transcription-related processes. RPRD1B is a transcriptional regulator which enhances expression of CCND1. It also enhances the transcription of a number of other cell cycle-related genes including CDK2, CDK4, CDK6 and cyclin-E but not CDKN1A, CDKN1B or cyclin-A.
References
  • Ni Z. et al., 2011, Transcription. 2 (5): 237-42.
  • Kristensen AR. et al., 2012, Nat Methods. 9 (9): 907-9.
  • Woods NT. et al., 2012, Sci Signal.5 (242): rs6.
  • TOP