Human RPRD1B Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:MGG707-CF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
981bp
Gene Synonym
CREPT, NET60, C20orf77, dJ1057B20.2, RPRD1B
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human regulation of nuclear pre-mRNA domain containing 1B Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
RPRD1B, together with RPRD1A, can accompany RNAP II from promoter regions to 3'-untranslated regions during transcription in vivo, predominantly interact with phosphorylated RNAP II, and can reduce CTD S5- and S7-phosphorylated RNAP II at target gene promoters. RNA polymerase II C-terminal domain (CTD) phosphorylation is important for various transcription-related processes. RPRD1B is a transcriptional regulator which enhances expression of CCND1. It also enhances the transcription of a number of other cell cycle-related genes including CDK2, CDK4, CDK6 and cyclin-E but not CDKN1A, CDKN1B or cyclin-A.
References
  • Ni Z. et al., 2011, Transcription. 2 (5): 237-42.
  • Kristensen AR. et al., 2012, Nat Methods. 9 (9): 907-9.
  • Woods NT. et al., 2012, Sci Signal.5 (242): rs6.
  • TOP