Mouse PTK6/Brk Gene ORF cDNA clone expression plasmid,N terminal His tag

Catalog Number:MGG265-NH

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1353bp
Gene Synonym
BRK, Sik, tks, Tksk, Ptk6
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse PTK6 protein tyrosine kinase 6 Gene ORF cDNA clone expression plasmid,N terminal His tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-His
Restriction Site
Protein Tag
His
Tag Sequence
CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
His Tag Information

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Tyrosine kinase (PTKs) is a protein that carry out tyrosine phosphorylation, which play a fundamental role in cell proliferation, survival, adhesion, and motility and have also been demenstrated to mediate malignant cell transformation. Overexpression of this protein in mammary epithelial cells leads to sensitization of the cells to epidermal growth factor and results in a partially transformed phenotype. Two classes of PTKs are present in cells: the transmembrane receptor PTKs and the non-receptor PTKs. Tyrosine kinase(PTKs)-6/ BRK is a cytoplasmic non-receptor protein kinase which may function as an intracellular signal transducer in epithelial tissues. Tyrosine kinase(PTKs)-6/ BRK has been shown to undergo autophosphorylation. It has been found that the constitutive expression of the tyrosine kinase(PTKs)-6/ BRK is in a large proportion of cutaneous T-cell lymphomas and other transformed T- and B-cell populations. State BRK expression was also induced in normal T-cells. In clinical, the cytoplasmic tyrosine kinase PTK6 (BRK) shows elevated expression in approximately two-thirds of primary breast tumours, and is implicated in EGF receptor-dependent signalling and epithelial tumorigenesis.
References
  • Aubele M, et al. (2008) Prognostic value of protein tyrosine kinase 6 (PTK6) for long-term survival of breast cancer patients.British Journal of Cancer. 99: 1089-95.
  • Kasprzycka M, et al. (2006) Expression and oncogenic role of Brk (PTK6/sik) protein tyrosine kinase in lymphocytes. American Journal of Pathology. 168: 1631-41.
  • Hubbard SR, et al. (2000) Protein tyrosine kinase structure and function. Annual review of biochemistry. 69: 373-98.
  • TOP