Mouse PTK6/Brk Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Mouse

NCBI Ref Seq

NM_009184.2

RefSeq ORF Size

1353bp

Gene Synonym

BRK, Sik, tks, Tksk, Ptk6

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse PTK6 protein tyrosine kinase 6 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Tyrosine kinase (PTKs) is a protein that carry out tyrosine phosphorylation, which play a fundamental role in cell proliferation, survival, adhesion, and motility and have also been demenstrated to mediate malignant cell transformation. Overexpression of this protein in mammary epithelial cells leads to sensitization of the cells to epidermal growth factor and results in a partially transformed phenotype. Two classes of PTKs are present in cells: the transmembrane receptor PTKs and the non-receptor PTKs. Tyrosine kinase(PTKs)-6/ BRK is a cytoplasmic non-receptor protein kinase which may function as an intracellular signal transducer in epithelial tissues. Tyrosine kinase(PTKs)-6/ BRK has been shown to undergo autophosphorylation. It has been found that the constitutive expression of the tyrosine kinase(PTKs)-6/ BRK is in a large proportion of cutaneous T-cell lymphomas and other transformed T- and B-cell populations. State BRK expression was also induced in normal T-cells. In clinical, the cytoplasmic tyrosine kinase PTK6 (BRK) shows elevated expression in approximately two-thirds of primary breast tumours, and is implicated in EGF receptor-dependent signalling and epithelial tumorigenesis.

References

Aubele M, et al. (2008) Prognostic value of protein tyrosine kinase 6 (PTK6) for long-term survival of breast cancer patients.British Journal of Cancer. 99: 1089-95.

Kasprzycka M, et al. (2006) Expression and oncogenic role of Brk (PTK6/sik) protein tyrosine kinase in lymphocytes. American Journal of Pathology. 168: 1631-41.

Hubbard SR, et al. (2000) Protein tyrosine kinase structure and function. Annual review of biochemistry. 69: 373-98.

Catalog Number:MGG265-CY