Mouse p22 BID Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Gene

Species

Mouse

NCBI Ref Seq

NM_007544.3

RefSeq ORF Size

588bp

Gene Synonym

AI875481, AU022477, 2700049M22Rik, Bid

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse BH3 interacting domain death agonist Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

The BH3 interacting domain death agonist (BID) is a pro-apoptotic member of the Bcl-2 protein family, which contains only the BH3 domain, and is required for its interaction with the Bcl-2 family proteins and for its pro-death activity. BID is important to cell death mediated by these proteases and thus is the sentinel to protease-mediated death signals. Recent studies further indicate that Bid may be more than just a killer molecule, it could be also involved in the maintenance of genomic stability by engaging at mitosis checkpoint. BID is an integrating key regulator of the intrinsic death pathway that amplifies caspase-dependent and caspase-independent execution of neuronal apoptosis. Therefore pharmacological inhibition of BID provides a promising therapeutic strategy in neurological diseases where programmed cell death is prominent. BID is activated by Caspase 8 in response to Fas/TNF-R1 death receptor activation. Activated BID is translocated to mitochondria and induces cytochrome c release, which in turn activates downstream caspases. BID action has been proposed to involve the mitochondrial re-location of its truncated form, tBid, to facilitate the release of apoptogenic proteins like cytochrome c.

References

Gross A. (2006) BID as a double agent in cell life and death. Cell Cycle. 5(6): 582-4.

Yin XM. (2007) Bid, a BH3-only multi-functional molecule, is at the cross road of life and death. Gene. 369: 7-19.

Esposti MD. (2002) The roles of Bid. Apoptosis. 7(5): 433-40.

Yin XM. (2000) Signal transduction mediated by Bid, a pro-death Bcl-2 family proteins, connects the death receptor and mitochondria apoptosis pathways. Cell Res. 10(3): 161-7.

Yin XM. (2000) Bid, a critical mediator for apoptosis induced by the activation of Fas/TNF-R1 death receptors in hepatocytes. J Mol Med. 78(4): 203-11.

Catalog Number:MGF562-CO