Mouse p22 BID Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Mouse

NCBI Ref Seq

NM_007544.3

RefSeq ORF Size

588bp

Gene Synonym

AI875481, AU022477, 2700049M22Rik, Bid

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse BH3 interacting domain death agonist Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

The BH3 interacting domain death agonist (BID) is a pro-apoptotic member of the Bcl-2 protein family, which contains only the BH3 domain, and is required for its interaction with the Bcl-2 family proteins and for its pro-death activity. BID is important to cell death mediated by these proteases and thus is the sentinel to protease-mediated death signals. Recent studies further indicate that Bid may be more than just a killer molecule, it could be also involved in the maintenance of genomic stability by engaging at mitosis checkpoint. BID is an integrating key regulator of the intrinsic death pathway that amplifies caspase-dependent and caspase-independent execution of neuronal apoptosis. Therefore pharmacological inhibition of BID provides a promising therapeutic strategy in neurological diseases where programmed cell death is prominent. BID is activated by Caspase 8 in response to Fas/TNF-R1 death receptor activation. Activated BID is translocated to mitochondria and induces cytochrome c release, which in turn activates downstream caspases. BID action has been proposed to involve the mitochondrial re-location of its truncated form, tBid, to facilitate the release of apoptogenic proteins like cytochrome c.

References

Gross A. (2006) BID as a double agent in cell life and death. Cell Cycle. 5(6): 582-4.

Yin XM. (2007) Bid, a BH3-only multi-functional molecule, is at the cross road of life and death. Gene. 369: 7-19.

Esposti MD. (2002) The roles of Bid. Apoptosis. 7(5): 433-40.

Yin XM. (2000) Signal transduction mediated by Bid, a pro-death Bcl-2 family proteins, connects the death receptor and mitochondria apoptosis pathways. Cell Res. 10(3): 161-7.

Yin XM. (2000) Bid, a critical mediator for apoptosis induced by the activation of Fas/TNF-R1 death receptors in hepatocytes. J Mol Med. 78(4): 203-11.

Catalog Number:MGF562-CM