Mouse OXSR1/OSR1 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Catalog Number:MGF557-CY

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1416bp
Gene Synonym
Osr1, AI462649, AW209236, mKIAA1101, 2210022N24Rik, 2810422B09Rik, Oxsr1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse oxidative-stress responsive 1 Gene ORF cDNA clone expression plasmid,C terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Oxidative stress-responsive 1 protein (OXSR1), also known as Serine/threonine-protein kinase OSR1, is a member of the Ser/Thr protein kinase family of proteins. OXSR1 regulates downstream kinases in response to environmental stress, and may play a role in regulating the actin cytoskeleton. OXSR1 is a 58 kDa protein of 527 amino acids that is widely expressed in mammalian tissues and cell lines. The amino acid (aa) sequence of the predicted OXSR1 protein is 39% identical to that of human SOK1. Of potential regulators surveyed, endogenous OXSR1 is activated only by osmotic stresses, notably sorbitol and to a lesser extent NaCl. OXSR1 did not increase the activity of coexpressed JNK, nor did it activate three other MAPKs, p38, ERK2, and ERK5. Phosphorylation by OXSR1 modulates the G protein sensitivity of PAK isoforms. The OXSR1 and SPAK are key enzymes in a signalling cascade regulating the activity of Na+/K+/2Cl- co-transporters (NKCCs) in response to osmotic stress. Both kinases have a conserved carboxy-terminal (CCT) domain, which recognizes a unique peptide (Arg-Phe-Xaa-Val) motif. The OXSR1 and SPAK kinases specifically recognize their upstream activators and downstream substrates.
References
TOP