Mouse OXSR1/OSR1 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:MGF557-CM

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1416bp
Gene Synonym
Osr1, AI462649, AW209236, mKIAA1101, 2210022N24Rik, 2810422B09Rik, Oxsr1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse oxidative-stress responsive 1 Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Oxidative stress-responsive 1 protein (OXSR1), also known as Serine/threonine-protein kinase OSR1, is a member of the Ser/Thr protein kinase family of proteins. OXSR1 regulates downstream kinases in response to environmental stress, and may play a role in regulating the actin cytoskeleton. OXSR1 is a 58 kDa protein of 527 amino acids that is widely expressed in mammalian tissues and cell lines. The amino acid (aa) sequence of the predicted OXSR1 protein is 39% identical to that of human SOK1. Of potential regulators surveyed, endogenous OXSR1 is activated only by osmotic stresses, notably sorbitol and to a lesser extent NaCl. OXSR1 did not increase the activity of coexpressed JNK, nor did it activate three other MAPKs, p38, ERK2, and ERK5. Phosphorylation by OXSR1 modulates the G protein sensitivity of PAK isoforms. The OXSR1 and SPAK are key enzymes in a signalling cascade regulating the activity of Na+/K+/2Cl- co-transporters (NKCCs) in response to osmotic stress. Both kinases have a conserved carboxy-terminal (CCT) domain, which recognizes a unique peptide (Arg-Phe-Xaa-Val) motif. The OXSR1 and SPAK kinases specifically recognize their upstream activators and downstream substrates.
References
TOP