Mouse OX40/TNFRSF4/CD134 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Gene

Species

Mouse

NCBI Ref Seq

NM_011659.2

RefSeq ORF Size

819bp

Gene Synonym

Ox40, ACT35, CD134, Ly-70, Txgp1, TXGP1L

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse tumor necrosis factor receptor superfamily, member 4 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

OX40 (CD134) and its binding partner, OX40L (CD252), are members of the tumor necrosis factor receptor/tumor necrosis factor superfamily, is known to break an existing state of tolerance in malignancies, leading to a reactivation of antitumor immunity. The interaction between OX40 and OX40L plays an important role in antigen-specific T-cell expansion and survival. OX40 and OX40L also regulate cytokine production from T cells, antigen-presenting cells, natural killer cells, and natural killer T cells, and modulate cytokine receptor signaling. In line with these important modulatory functions, OX40-OX40L interactions have been found to play a central role in the development of multiple inflammatory and autoimmune diseases, making them attractive candidates for intervention in the clinic. Conversely, stimulating OX40 has shown it to be a candidate for therapeutic immunization strategies for cancer and infectious disease.

References

Compaan D.M., et al. (2006) .The crystal structure of the costimulatory OX40-OX40L complex. Structure 14:1321-1330.

Kawamata S., et al. (1998) .Activation of OX40 signal transduction pathways leads to tumor necrosis factor receptor-associated factor (TRAF) 2- and TRAF5-mediated NF-kappaB activation. J. Biol. Chem. 273:5808-5814.

Byun M., (2013) Inherited human OX40 deficiency underlying classic Kaposi sarcoma of childhood. J. Exp. Med. 210:1743-1759.

Catalog Number:MGF550-NY