Mouse OX40/TNFRSF4/CD134 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:MGF550-NM

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
819bp
Gene Synonym
Ox40, ACT35, CD134, Ly-70, Txgp1, TXGP1L
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse tumor necrosis factor receptor superfamily, member 4 Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
OX40 (CD134) and its binding partner, OX40L (CD252), are members of the tumor necrosis factor receptor/tumor necrosis factor superfamily, is known to break an existing state of tolerance in malignancies, leading to a reactivation of antitumor immunity. The interaction between OX40 and OX40L plays an important role in antigen-specific T-cell expansion and survival. OX40 and OX40L also regulate cytokine production from T cells, antigen-presenting cells, natural killer cells, and natural killer T cells, and modulate cytokine receptor signaling. In line with these important modulatory functions, OX40-OX40L interactions have been found to play a central role in the development of multiple inflammatory and autoimmune diseases, making them attractive candidates for intervention in the clinic. Conversely, stimulating OX40 has shown it to be a candidate for therapeutic immunization strategies for cancer and infectious disease.
References
  • Compaan D.M., et al. (2006) .The crystal structure of the costimulatory OX40-OX40L complex. Structure 14:1321-1330.
  • Kawamata S., et al. (1998) .Activation of OX40 signal transduction pathways leads to tumor necrosis factor receptor-associated factor (TRAF) 2- and TRAF5-mediated NF-kappaB activation. J. Biol. Chem. 273:5808-5814.
  • Byun M., (2013) Inherited human OX40 deficiency underlying classic Kaposi sarcoma of childhood. J. Exp. Med. 210:1743-1759.
  • TOP