Mouse Oncostatin M/OSM Gene ORF cDNA clone expression plasmid,N terminal His tag

Catalog Number:MGF487-NH

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
792bp
Gene Synonym
OSM
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse Oncostatin M Gene ORF cDNA clone expression plasmid,N terminal His tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-His
Restriction Site
Protein Tag
His
Tag Sequence
CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
His Tag Information

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Oncostatin M (OSM) is a glycoprotein belonging to the interleukin-6 family of cytokines that has functions mainly in cell growth. Oncostatin M (OSM) is considered as a pleiotropic cytokine that signals through cell surface receptors typeⅠand typeⅡ both of which share the similarity of containing protein gp130 and takes part in many biometabolism processes including liver development, haematopoeisis, inflammation, bone formation and destruction and possibly CNS development. Oncostatin M (OSM) was previoustly identified by its ability to inhibit the growth of cells from melanoma and other solid tumors. It also has been reported that OSM, like LIF, IL-6 and G-CSF, has the ability to inhibit the proliferation of murine M1 myeloid leukemic cells and can induce their differentiation into macrophage-like cells. The human form of OSM is insensitive between pH2 and 11 and resistant to heating for one hour at 56 degree but is not stable at 90 degrees. The human OSM is produced as a precursor containing 252 amino acids, whose first 25 amino acids function as a secretory signal peptide and which on removal yields the soluble 227 amino acid pro-OSM. Removal of the C-teminal most 31 amino acids produces the fully active 196 residue form.
References
  • Tanaka M, et al. (2003) Oncostatin M, a multifunctional cytokine. Rev Physiol Biochem Pharmacol. Reviews of Physiology, Biochemistry and Pharmacology. 149: 39-52.
  • Auguste P, et al. (1997) Signaling of type II oncostatin M receptor. J Biol Chem. 272 (25): 15760-4.
  • Zarling JM, et al. (1986). Oncostatin M: a growth regulator produced by differentiated histiocytic lymphoma cells. Proc Natl Acad Sci. 83 (24): 9739-43.
  • TOP