Mouse Oncostatin M/OSM Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Gene

Species

Mouse

NCBI Ref Seq

NM_001013365.1

RefSeq ORF Size

792bp

Gene Synonym

OSM

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse Oncostatin M Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Oncostatin M (OSM) is a glycoprotein belonging to the interleukin-6 family of cytokines that has functions mainly in cell growth. Oncostatin M (OSM) is considered as a pleiotropic cytokine that signals through cell surface receptors typeⅠand typeⅡ both of which share the similarity of containing protein gp130 and takes part in many biometabolism processes including liver development, haematopoeisis, inflammation, bone formation and destruction and possibly CNS development. Oncostatin M (OSM) was previoustly identified by its ability to inhibit the growth of cells from melanoma and other solid tumors. It also has been reported that OSM, like LIF, IL-6 and G-CSF, has the ability to inhibit the proliferation of murine M1 myeloid leukemic cells and can induce their differentiation into macrophage-like cells. The human form of OSM is insensitive between pH2 and 11 and resistant to heating for one hour at 56 degree but is not stable at 90 degrees. The human OSM is produced as a precursor containing 252 amino acids, whose first 25 amino acids function as a secretory signal peptide and which on removal yields the soluble 227 amino acid pro-OSM. Removal of the C-teminal most 31 amino acids produces the fully active 196 residue form.

References

Tanaka M, et al. (2003) Oncostatin M, a multifunctional cytokine. Rev Physiol Biochem Pharmacol. Reviews of Physiology, Biochemistry and Pharmacology. 149: 39-52.

Auguste P, et al. (1997) Signaling of type II oncostatin M receptor. J Biol Chem. 272 (25): 15760-4.

Zarling JM, et al. (1986). Oncostatin M: a growth regulator produced by differentiated histiocytic lymphoma cells. Proc Natl Acad Sci. 83 (24): 9739-43.

Catalog Number:MGF487-CO