Mouse Nogo Receptor Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Gene

Species

Mouse

NCBI Ref Seq

NM_022982.2

RefSeq ORF Size

1422bp

Gene Synonym

NgR, NOGOR

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse reticulon 4 receptor Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Reticulon 4 receptor (RTN4R), also known as Nogo-66 Receptor (NgR), is a glycosylphosphoinositol (GPI)-anchored protein that belongs to the Nogo recptor family including three members. Mouse RTN4R cDNA contains 10 LRP (Leucine-rich) repeats. RTN4R is expressed predominantly in neurons and their axons in the central nervous systems (CNS). As a receptor for myelin-derived proteins Nogo, myelin-associated glycoprotein (MAG), and myelin oligodendrocyte glycoprotein (OMG), RTN4R mediates axonal growth inhibition and may play a role in regulating axonal regeneration and plasticity in the adult CNS. It has been shown that RTN4R performs its inhibitory actions by interacting with the p75 neurotrophin receptor (p75NTR), a TNFRSF member also known for modulating the activities of the Trk family and for inducing apoptosis in neurons and oligodendrocytes. RTN4R may be proposed as a potential drug target for treatment of various neurological conditions such as spinal cord injury, CNS lesions, peripheral nerve injury, stroke and Alzheimer's disease (AD). Additionally, RTN4R may play a role in regulating the function of the gap junctions.

References

1. Wang, X. et al., 2006, Ann Neurol. 60(5): 540-549.

2. Wang, Y.Z. et al., 2006, Neuroreport.17(6):605-609.

3. Zhu, H.Y. et al., 2007, Hum Pathol. 38(3): 426-434.

4. David, S. et al., 2008, Trends Neurosci. 31(5): 221-226.

5. Jiang, W. et al., 2009, Transl Res. 154(1): 40-48.

6. Zhang, L. et al., 2009, J Neurosci, 9(19): 6348-6352.

Catalog Number:MGF327-NF