Mouse Nogo Receptor Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:MGF327-CM

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1422bp
Gene Synonym
NgR, NOGOR
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse reticulon 4 receptor Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Reticulon 4 receptor (RTN4R), also known as Nogo-66 Receptor (NgR), is a glycosylphosphoinositol (GPI)-anchored protein that belongs to the Nogo recptor family including three members. Mouse RTN4R cDNA contains 10 LRP (Leucine-rich) repeats. RTN4R is expressed predominantly in neurons and their axons in the central nervous systems (CNS). As a receptor for myelin-derived proteins Nogo, myelin-associated glycoprotein (MAG), and myelin oligodendrocyte glycoprotein (OMG), RTN4R mediates axonal growth inhibition and may play a role in regulating axonal regeneration and plasticity in the adult CNS. It has been shown that RTN4R performs its inhibitory actions by interacting with the p75 neurotrophin receptor (p75NTR), a TNFRSF member also known for modulating the activities of the Trk family and for inducing apoptosis in neurons and oligodendrocytes. RTN4R may be proposed as a potential drug target for treatment of various neurological conditions such as spinal cord injury, CNS lesions, peripheral nerve injury, stroke and Alzheimer's disease (AD). Additionally, RTN4R may play a role in regulating the function of the gap junctions.
References

1. Wang, X. et al., 2006, Ann Neurol. 60(5): 540-549.      

2. Wang, Y.Z. et al., 2006, Neuroreport.17(6):605-609.       

3. Zhu, H.Y. et al., 2007, Hum Pathol. 38(3): 426-434.           

4. David, S. et al., 2008, Trends Neurosci. 31(5): 221-226.       

5. Jiang, W. et al., 2009, Transl Res. 154(1): 40-48.      

6. Zhang, L. et al., 2009, J Neurosci, 9(19): 6348-6352.

TOP