Mouse MST4/MST-4 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Mouse

NCBI Ref Seq

NM_133729.1

RefSeq ORF Size

1020bp

Gene Synonym

Mst4, RP23-245F8.1, 2610018G03Rik

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse RIKEN cDNA 2610018G03 gene Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

MST4, also known as mammalian STE20-like protein kinase 4, is a novel member of the germinal center kinase subfamily of human Ste20-like kinases and is closely related to MST3. The 416 amino acid full-length MST4 contains a C-terminal regulatory domain and an N-terminal kinase domain, both of which are required for full activation of the kinase. MST4 is highly expressed in placenta, thymus, and peripheral blood leukocytes. MST4 specifically activates ERK but not JNK or p38 MAPK in transient transfected cells or in stable cell lines, and thus is biologically active in the activation of MEK/ERK pathway mediating cell growth and transformation. Further, MST4 kinase activity is stimulated significantly by epidermal growth factor receptor (EGFR) ligands, which are known to promote growth of certain cancer cells. Accordingly, MST4 have a potential role in signal transduction pathways involved in cancer progression. Three alternatively spliced isoform of MST4 have been isolated, and isoform 3 lacks an exon encoding kinase domain and may function as a dominant-negative regulator of the MST4 kinase.

References

1. Qian, Z. et al., 2001, J Biol Chem. 276 :22439-45.

2. Lin, JL. et al., 2001, Oncogene. 20: 6559-6569.

3. Sung V, et al., 2003, Cancer research. 63: 3356-63.

4. Ma, X. et al., 2007, Molecular biology of the cell. 18:1965-78.

5. ten Klooster JP, et al., 2009, Developmental cell. 16:551-62.

Catalog Number:MGF028-CF