Mouse MARCO Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Catalog Number:MGE694-CO

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1557bp
Gene Synonym
Ly112; Scara2; AI323439; Marco
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse macrophage receptor with collagenous structure Gene ORF cDNA clone expression plasmid,C terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Macrophage receptor MARCO, also known as Macrophage receptor with collagenous structure and Marco, is a single-pass type I I membrane protein. MARCO is a member of the class A scavenger receptor family and is part of the innate antimicrobial immune system. It is expressed in subpopulations of macrophages in the spleen and the medullary cord of lymph nodes. Although it is expressed on subsets of macrophages, it can be upregulated on other macrophages after bacterial infection. The strategic position of MARCO-expressing cells in lymphoid organs suggests an important role for this bacteria-binding molecule in removal of pathogens. MARCO has a short N-terminal cytoplasmic domain, a transmembrane domain, and a large extracellular part composed of a 75-residue long spacer domain, a 270-residue collagenous domain, and a 99-residue long scavenger receptor cysteine-rich (SRCR) domain. It is possible that cooperation between the SRCR domain and the collagenous domain is needed for high-affinity bacterial binding, or that the SRCR domain has to be in a trimeric form to effectively bind to bacteria
References
  • Kraal, G. et al., 2000, Microbes Infect . 2 (3): 313-6.
  • Sankala, M., 2002, J Biol Chem. 277 (36): 33378-85.
  • Arredouani, MS., 2004, Cell Mol Biol. 50 Online Pub : OL657-65.
  • Thakur, SA., 2009, Toxicol Sci. 107 (1): 238-46.
  • TOP