Mouse MARCO Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:MGE694-CF

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1557bp
Gene Synonym
Ly112; Scara2; AI323439; Marco
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse macrophage receptor with collagenous structure Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Macrophage receptor MARCO, also known as Macrophage receptor with collagenous structure and Marco, is a single-pass type I I membrane protein. MARCO is a member of the class A scavenger receptor family and is part of the innate antimicrobial immune system. It is expressed in subpopulations of macrophages in the spleen and the medullary cord of lymph nodes. Although it is expressed on subsets of macrophages, it can be upregulated on other macrophages after bacterial infection. The strategic position of MARCO-expressing cells in lymphoid organs suggests an important role for this bacteria-binding molecule in removal of pathogens. MARCO has a short N-terminal cytoplasmic domain, a transmembrane domain, and a large extracellular part composed of a 75-residue long spacer domain, a 270-residue collagenous domain, and a 99-residue long scavenger receptor cysteine-rich (SRCR) domain. It is possible that cooperation between the SRCR domain and the collagenous domain is needed for high-affinity bacterial binding, or that the SRCR domain has to be in a trimeric form to effectively bind to bacteria
References
  • Kraal, G. et al., 2000, Microbes Infect . 2 (3): 313-6.
  • Sankala, M., 2002, J Biol Chem. 277 (36): 33378-85.
  • Arredouani, MS., 2004, Cell Mol Biol. 50 Online Pub : OL657-65.
  • Thakur, SA., 2009, Toxicol Sci. 107 (1): 238-46.
  • TOP