Mouse MAPKAPK3/MK3 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Mouse

NCBI Ref Seq

NM_178907.3

RefSeq ORF Size

1155bp

Gene Synonym

3PK, MK3, MAPKAP3, AI874665, MapkKapk3, Mapkapk3

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse mitogen-activated protein kinase-activated protein kinase 3 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

The MAPKAP kinases are a group of MAP kinase substrates which are themselves kinases. In response to activation, the MAP kinases phosphorylate downstream components on a consensus Pro-X-Ser/Thr-Pro motif. Several kinases that contain this motif have been identifed and serve as substrates for the ERK and p38 MAP kinases. Mitogen-activated protein (MAP) kinase-activated protein kinase 3, also known as MAPKAPK-3 and 3pK, is a member of the Ser/Thr protein kinase family. It is Widely expressed in human tissues, with a higher expression level observed in heart and skeletal muscle. No expression in brain. MAPKAPK-3 is unique since it was shown to be activated by three members of the MAPK family, namely extracellular-signal-regulated kinase (ERK), p38, and Jun-N-terminal kinase (JNK). It is highly activated both by mitogens and by stress-inducing agents or proinflammatory cytokines, and translocates to the cytoplasm from nucleus. MAPKAPK-3 is exclusively activated via the classical MAPK cascade, while stress-induced activation of MAPKAPK-3 is mainly mediated by p38, however the mechanism defining the specificity remains unknown.

References

McLaughlin, M.M. et al., 1996, J. Biol. Chem. 271:8488-8492.

Tanoue, T. et al., 2001, EMBO J. 20: 466-479.

Neufeld, B. et al., 2000, J. Biol. Chem. 275: 20239-20242.

Zakowski,V. et al., 2004, Exp Cell Res. 299: 101-109.

Voncken, J. W. et al., 2005, J. Biol. Chem. 280: 5178-5187.

Catalog Number:MGE683-CY