Mouse MAPKAPK3/MK3 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Mouse

NCBI Ref Seq

NM_178907.3

RefSeq ORF Size

1155bp

Gene Synonym

3PK, MK3, MAPKAP3, AI874665, MapkKapk3, Mapkapk3

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse mitogen-activated protein kinase-activated protein kinase 3 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

The MAPKAP kinases are a group of MAP kinase substrates which are themselves kinases. In response to activation, the MAP kinases phosphorylate downstream components on a consensus Pro-X-Ser/Thr-Pro motif. Several kinases that contain this motif have been identifed and serve as substrates for the ERK and p38 MAP kinases. Mitogen-activated protein (MAP) kinase-activated protein kinase 3, also known as MAPKAPK-3 and 3pK, is a member of the Ser/Thr protein kinase family. It is Widely expressed in human tissues, with a higher expression level observed in heart and skeletal muscle. No expression in brain. MAPKAPK-3 is unique since it was shown to be activated by three members of the MAPK family, namely extracellular-signal-regulated kinase (ERK), p38, and Jun-N-terminal kinase (JNK). It is highly activated both by mitogens and by stress-inducing agents or proinflammatory cytokines, and translocates to the cytoplasm from nucleus. MAPKAPK-3 is exclusively activated via the classical MAPK cascade, while stress-induced activation of MAPKAPK-3 is mainly mediated by p38, however the mechanism defining the specificity remains unknown.

References

McLaughlin, M.M. et al., 1996, J. Biol. Chem. 271:8488-8492.

Tanoue, T. et al., 2001, EMBO J. 20: 466-479.

Neufeld, B. et al., 2000, J. Biol. Chem. 275: 20239-20242.

Zakowski,V. et al., 2004, Exp Cell Res. 299: 101-109.

Voncken, J. W. et al., 2005, J. Biol. Chem. 280: 5178-5187.

Catalog Number:MGE683-CF