Mouse LYPLA2 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Mouse

NCBI Ref Seq

NM_011942.1

RefSeq ORF Size

696bp

Gene Synonym

LysoII

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse lysophospholipase 2 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Lysophospholipase II (LYPLA2, LPL-II, or LysoPLA II), also known as Acyl-protein thioesterase 2 (APT-2), belongs to the AB hydrolase 2 family. This enzyme has lysophospholipase activity, and may hydrolyze fatty acids from S-acylated cysteine residues in proteins such as trimeric G alpha proteins or HRAS. Acyl-protein thioesterase 1 (APT-1) and Acyl-protein thioesterase 2 (APT-2) are cytosolic lysophospholipid hydrolyzing enzymes. The serum activity of APT-1 may play an important role in determination of the concentration of des-acyl ghrelin in circulation, especially under septic inflammation. APT-2/LYPLA2 is expressed both in CHO-K1 and HeLa cells and its overexpression increased the deacylation rate of single acylated GAP-43 and affected the steady-state localization of diacylated GAP-43 and H-Ras. Thus, the results demonstrate that APT-2/LYPLA2 is the protein thioesterase involved in the acylation/deacylation cycle operating in GAP-43 subcellular distribution.

References

Satou M, et al. (2010) Identification and characterization of acyl-protein thioesterase 1/lysophospholipase I as a ghrelin deacylation/lysophospholipid hydrolyzing enzyme in fetal bovine serum and conditioned medium. Endocrinology. 151(10): 4765-75.

Tomatis VM, et al. (2010) Acyl-protein thioesterase 2 catalyzes the deacylation of peripheral membrane-associated GAP-43. PLoS One. 5(11): e15045.

Catalog Number:MGE605-NM