Mouse LYPLA2 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Mouse

NCBI Ref Seq

NM_011942.1

RefSeq ORF Size

696bp

Gene Synonym

LysoII

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse lysophospholipase 2 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Lysophospholipase II (LYPLA2, LPL-II, or LysoPLA II), also known as Acyl-protein thioesterase 2 (APT-2), belongs to the AB hydrolase 2 family. This enzyme has lysophospholipase activity, and may hydrolyze fatty acids from S-acylated cysteine residues in proteins such as trimeric G alpha proteins or HRAS. Acyl-protein thioesterase 1 (APT-1) and Acyl-protein thioesterase 2 (APT-2) are cytosolic lysophospholipid hydrolyzing enzymes. The serum activity of APT-1 may play an important role in determination of the concentration of des-acyl ghrelin in circulation, especially under septic inflammation. APT-2/LYPLA2 is expressed both in CHO-K1 and HeLa cells and its overexpression increased the deacylation rate of single acylated GAP-43 and affected the steady-state localization of diacylated GAP-43 and H-Ras. Thus, the results demonstrate that APT-2/LYPLA2 is the protein thioesterase involved in the acylation/deacylation cycle operating in GAP-43 subcellular distribution.

References

Satou M, et al. (2010) Identification and characterization of acyl-protein thioesterase 1/lysophospholipase I as a ghrelin deacylation/lysophospholipid hydrolyzing enzyme in fetal bovine serum and conditioned medium. Endocrinology. 151(10): 4765-75.

Tomatis VM, et al. (2010) Acyl-protein thioesterase 2 catalyzes the deacylation of peripheral membrane-associated GAP-43. PLoS One. 5(11): e15045.

Catalog Number:MGE605-CF