Mouse KLK4/Kallikrein 4 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Mouse

NCBI Ref Seq

NM_019928.1

RefSeq ORF Size

768bp

Gene Synonym

PSTS, ESMP1, KLK-L1, Prss17, Klk4

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse kallikrein related-peptidase 4 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Kallikrein-4, also known as Enamel matrix serine proteinase 1, Kallikrein-like protein 1, KLK-L1, Serine protease 17, KLK4, PRSS17 and EMSP1, is a secreted protein which belongs to the peptidase S1 family and Kallikrein subfamily. Kallikrein-4 / KLK4 is a serine protease expressed during enamel maturation, and proteolytic processing of the enamel matrix by KLK4 is critical for proper enamel formation. Kallikrein-4 / KLK4 contains one peptidase S1 domain. Kallikrein-4 / KLK4 is secreted by transition- and maturation-stage ameloblasts. KLK4 aggressively degrades the retained organic matrix following the termination of enamel protein secretion. Two proteases are secreted into the enamel matrix of developing teeth. The early protease is enamelysin (MMP-20). The late protease is kallikrein 4 (KLK4). The principle functions of MMP-20 and KLK4 in dental enamel formation are to facilitate the orderly replacement of organic matrix with mineral, generating an enamel layer that is harder, less porous, and unstained by retained enamel proteins. Defects in Kallikrein-4 / KLK4 are the cause of amelogenesis imperfecta hypomaturation type 2A1 (AI2A1) which is an autosomal recessive defect of enamel formation. The disorder involves both primary and secondary dentitions.

References

Catalog Number:MGE201-NM