Mouse KLK4/Kallikrein 4 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:MGE201-NF

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
768bp
Gene Synonym
PSTS, ESMP1, KLK-L1, Prss17, Klk4
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse kallikrein related-peptidase 4 Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Kallikrein-4, also known as Enamel matrix serine proteinase 1, Kallikrein-like protein 1, KLK-L1, Serine protease 17, KLK4, PRSS17 and EMSP1, is a secreted protein which belongs to the peptidase S1 family and Kallikrein subfamily. Kallikrein-4 / KLK4 is a serine protease expressed during enamel maturation, and proteolytic processing of the enamel matrix by KLK4 is critical for proper enamel formation. Kallikrein-4 / KLK4 contains one peptidase S1 domain. Kallikrein-4 / KLK4 is secreted by transition- and maturation-stage ameloblasts. KLK4 aggressively degrades the retained organic matrix following the termination of enamel protein secretion. Two proteases are secreted into the enamel matrix of developing teeth. The early protease is enamelysin (MMP-20). The late protease is kallikrein 4 (KLK4). The principle functions of MMP-20 and KLK4 in dental enamel formation are to facilitate the orderly replacement of organic matrix with mineral, generating an enamel layer that is harder, less porous, and unstained by retained enamel proteins. Defects in Kallikrein-4 / KLK4 are the cause of amelogenesis imperfecta hypomaturation type 2A1 (AI2A1) which is an autosomal recessive defect of enamel formation. The disorder involves both primary and secondary dentitions.
References
TOP