Mouse JNK1 / MAPK8 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Gene

Species

Mouse

NCBI Ref Seq

NM_016700.3

RefSeq ORF Size

1155bp

Gene Synonym

JNK, JNK1, Prkm8, SAPK1, AI849689

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse mitogen-activated protein kinase 8 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Mitogen-activated protein kinase 8 (MAPK8), also known as JNK1, is a member of the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. The protein kinases JNK1 has been found to serve as critical molecular links between obesity, metabolic inflammation, and disorders of glucose homeostasis. It is critically involved in the promotion of diet-induced obesity, metabolic inflammation and beta-cell dysfunction. The selective deficiency of JNK1 in the murine nervous system is sufficient to suppress diet-induced obesity. Genetic analysis indicates that the effects of JNK1 can be separated from effects of JNK1 on obesity. JNK1 is a potential pharmacological target for the development of drugs that might be useful for the treatment of metabolic syndrome, and type 2 diabetes. Furthermore, JNK1 plays a major role in the hypoxic cellular damage. JNK1 protein might be an attractive target for antihypoxic therapy in increasing resistance to many pathological conditions and diseases, leading to the oxygen deficit.

References

Betigeri S, et al. (2006) JNK1 as a molecular target to limit cellular mortality under hypoxia. Mol Pharm. 3(4): 424-30.

Solinas G, et al. (2010) JNK1 and IKKbeta: molecular links between obesity and metabolic dysfunction. FASEB J. 24(8): 2596-611.

Sabio G, et al. (2010) Role of the hypothalamic-pituitary-thyroid axis in metabolic regulation by JNK1. Genes Dev. 24(3): 256-64.

Catalog Number:MGE084-NO