Mouse JNK1 / MAPK8 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Mouse

NCBI Ref Seq

NM_016700.3

RefSeq ORF Size

1155bp

Gene Synonym

JNK, JNK1, Prkm8, SAPK1, AI849689

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse mitogen-activated protein kinase 8 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Mitogen-activated protein kinase 8 (MAPK8), also known as JNK1, is a member of the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. The protein kinases JNK1 has been found to serve as critical molecular links between obesity, metabolic inflammation, and disorders of glucose homeostasis. It is critically involved in the promotion of diet-induced obesity, metabolic inflammation and beta-cell dysfunction. The selective deficiency of JNK1 in the murine nervous system is sufficient to suppress diet-induced obesity. Genetic analysis indicates that the effects of JNK1 can be separated from effects of JNK1 on obesity. JNK1 is a potential pharmacological target for the development of drugs that might be useful for the treatment of metabolic syndrome, and type 2 diabetes. Furthermore, JNK1 plays a major role in the hypoxic cellular damage. JNK1 protein might be an attractive target for antihypoxic therapy in increasing resistance to many pathological conditions and diseases, leading to the oxygen deficit.

References

Betigeri S, et al. (2006) JNK1 as a molecular target to limit cellular mortality under hypoxia. Mol Pharm. 3(4): 424-30.

Solinas G, et al. (2010) JNK1 and IKKbeta: molecular links between obesity and metabolic dysfunction. FASEB J. 24(8): 2596-611.

Sabio G, et al. (2010) Role of the hypothalamic-pituitary-thyroid axis in metabolic regulation by JNK1. Genes Dev. 24(3): 256-64.

Catalog Number:MGE084-CF