Mouse JAM-C/JAM3 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Mouse

NCBI Ref Seq

NM_023277.3

RefSeq ORF Size

933bp

Gene Synonym

JAM-3, JAM-C, Jcam3, C85515, 1110002N23Rik, Jam3

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse junction adhesion molecule 3 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Junctional Adhesion Molecule C Protein & Antibody (JAM-C, JAM3 Protein) also known as Junctional adhesion molecule 3, JAM3, is a single-pass type I membrane protein which belongs to the immunoglobulin superfamily. It is an adhesion molecule expressed by endothelial cells (ECs) that plays a role in tight junction formation, leukocyte adhesion, and transendothelial migration. JAM-C is an adhesion molecule that is expressed on cells within the vascular compartment and epithelial cells and, to date, has been largely studied in the context of inflammatory events. JAM-C is also expressed in peripheral nerves and that this expression is localized to Schwann cells at junctions between adjoining myelin end loops. JAM-C is a component of the autotypic junctional attachments of Schwann cells and plays an important role in maintaining the integrity and function of myelinated peripheral nerves. JAM-C was recently shown to be a counter receptor for the leukocyte beta2-integrin Mac-1 (CD11b/CD18), thereby mediating interactions between vascular cells, particularly in inflammatory cell recruitment. JAM-C is up-regulated by oxidized low-density lipoprotein (LDL) and may thereby contribute to increased inflammatory cell recruitment during atherosclerosis. JAM-C may therefore provide a novel molecular target for antagonizing interactions between vascular cells in atherosclerosis. JAM-C was shown to undergo a heterophilic interaction with the leukocyte beta2 integrin Mac-1, thereby mediating interactions between vascular cells in inflammatory cell recruitment. JAM-C undergoes a homophilic interaction via the Arg64-Ile65-Glu66 motif on the membrane-distal Ig domain of the molecule. The homophilic interaction of JAM-C can mediate tumor cell-endothelial cell interactions and may thereby be involved in the process of tumor cell metastasis.

References

Keiper T, et al. (2005) The role of junctional adhesion molecule-C (JAM-C) in oxidized LDL-mediated leukocyte recruitment. FASEB J. 19(14): 2078-80.

Santoso S, et al. (2005) The homophilic binding of junctional adhesion molecule-C mediates tumor cell-endothelial cell interactions. J Biol Chem. 280(43): 36326-33.

Scheiermann C, et al. (2007) Expression and function of junctional adhesion molecule-C in myelinated peripheral nerves. Science. 318(5855): 1472-5.

Mandicourt G, et al. (2007) JAM-C regulates tight junctions and integrin-mediated cell adhesion and migration. J Biol Chem. 282(3): 1830-7.

Betanzos A, et al. (2009) Evidence for cross-reactivity of JAM-C antibodies: implications for cellular localization studies. Biol Cell. 101(8): 441-53.

Rabquer BJ, et al. (2010) Junctional adhesion molecule-C is a soluble mediator of angiogenesis. J Immunol. 185(3): 1777-85.

Catalog Number:MGE076-NM