Mouse JAM-C/JAM3 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Catalog Number:MGE076-CO

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
933bp
Gene Synonym
JAM-3, JAM-C, Jcam3, C85515, 1110002N23Rik, Jam3
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse junction adhesion molecule 3 Gene ORF cDNA clone expression plasmid,C terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Junctional Adhesion Molecule C Protein & Antibody (JAM-C, JAM3 Protein) also known as Junctional adhesion molecule 3, JAM3, is a single-pass type I membrane protein which belongs to the immunoglobulin superfamily. It is an adhesion molecule expressed by endothelial cells (ECs) that plays a role in tight junction formation, leukocyte adhesion, and transendothelial migration. JAM-C is an adhesion molecule that is expressed on cells within the vascular compartment and epithelial cells and, to date, has been largely studied in the context of inflammatory events. JAM-C is also expressed in peripheral nerves and that this expression is localized to Schwann cells at junctions between adjoining myelin end loops. JAM-C is a component of the autotypic junctional attachments of Schwann cells and plays an important role in maintaining the integrity and function of myelinated peripheral nerves. JAM-C was recently shown to be a counter receptor for the leukocyte beta2-integrin Mac-1 (CD11b/CD18), thereby mediating interactions between vascular cells, particularly in inflammatory cell recruitment. JAM-C is up-regulated by oxidized low-density lipoprotein (LDL) and may thereby contribute to increased inflammatory cell recruitment during atherosclerosis. JAM-C may therefore provide a novel molecular target for antagonizing interactions between vascular cells in atherosclerosis. JAM-C was shown to undergo a heterophilic interaction with the leukocyte beta2 integrin Mac-1, thereby mediating interactions between vascular cells in inflammatory cell recruitment. JAM-C undergoes a homophilic interaction via the Arg64-Ile65-Glu66 motif on the membrane-distal Ig domain of the molecule. The homophilic interaction of JAM-C can mediate tumor cell-endothelial cell interactions and may thereby be involved in the process of tumor cell metastasis.
References
  • Keiper T, et al. (2005) The role of junctional adhesion molecule-C (JAM-C) in oxidized LDL-mediated leukocyte recruitment. FASEB J. 19(14): 2078-80.
  • Santoso S, et al. (2005) The homophilic binding of junctional adhesion molecule-C mediates tumor cell-endothelial cell interactions. J Biol Chem. 280(43): 36326-33.
  • Scheiermann C, et al. (2007) Expression and function of junctional adhesion molecule-C in myelinated peripheral nerves. Science. 318(5855): 1472-5.
  • Mandicourt G, et al. (2007) JAM-C regulates tight junctions and integrin-mediated cell adhesion and migration. J Biol Chem. 282(3): 1830-7.
  • Betanzos A, et al. (2009) Evidence for cross-reactivity of JAM-C antibodies: implications for cellular localization studies. Biol Cell. 101(8): 441-53.
  • Rabquer BJ, et al. (2010) Junctional adhesion molecule-C is a soluble mediator of angiogenesis. J Immunol. 185(3): 1777-85.
  • TOP