Rat Interferon beta/IFN-beta/IFNB1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Rat

NCBI Ref Seq

NM_019127.1

RefSeq ORF Size

555bp

Gene Synonym

Ifnb, Ifnb1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat interferon beta 1, fibroblast Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Interferons (IFNs) are natural glycoproteins belonging to the cytokine superfamily, and are produced by the cells of the immune system of most vertebrates in response to challenges by foreign agents such as viruses, parasites and tumor cells. Interferon-beta (IFN beta) is an extra-cellular protein mediator of host defense and homeostasis. IFN beta has well-established direct antiviral, antiproliferative and immunomodulatory properties. Recombinant IFN beta is approved for the treatment of relapsing-remitting multiple sclerosis. The recombinant IFN beta protein has the theoretical potential to either treat or cause autoimmune neuromuscular disorders by altering the complicated and delicate balances within the immune system networks. It is the most widely prescribed disease-modifying therapy for multiple sclerosis (MS). Large-scale clinical trials have established the clinical efficacy of IFN beta in reducing relapses and slowing disease progression in relapsing-remitting MS. IFN beta therapy was shown to be comparably beneficial for opticospinal MS (OSMS) and conventional MS in Japanese. IFN beta is effective in reducing relapses in secondary progressive MS and may have a modest effect in slowing disability progression. In addition to the common antiviral activity, IFN beta also induces increased production of the p53 gene product which promotes apoptosis, and thus has therapeutic effect against certain cancers. The role of IFN-beta in bone metabolism could warrant its systematic evaluation as a potential adjunct to therapeutic regimens of osteolytic diseases. Furthermore, IFN beta might play a beneficial role in the development of a chronic progressive CNS inflammation.

References

Kohriyama T, et al. (2008) Interferon-beta treatment for multiple sclerosis and predictors of response. Nippon Rinsho. 66(6): 1119-26.

Stbgen JP. (2009) Recombinant interferon-beta therapy and neuromuscular disorders. J Neuroimmunol. 212(1-2): 132-41.

Abraham AK, et al. (2009) Mechanisms of interferon-beta effects on bone homeostasis. Biochem Pharmacol. 77(12): 1757-62.

Catalog Number:MGE012-NM