Rat Interferon beta/IFN-beta/IFNB1 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Rat

NCBI Ref Seq

NM_019127.1

RefSeq ORF Size

555bp

Gene Synonym

Ifnb, Ifnb1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat interferon beta 1, fibroblast Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Interferons (IFNs) are natural glycoproteins belonging to the cytokine superfamily, and are produced by the cells of the immune system of most vertebrates in response to challenges by foreign agents such as viruses, parasites and tumor cells. Interferon-beta (IFN beta) is an extra-cellular protein mediator of host defense and homeostasis. IFN beta has well-established direct antiviral, antiproliferative and immunomodulatory properties. Recombinant IFN beta is approved for the treatment of relapsing-remitting multiple sclerosis. The recombinant IFN beta protein has the theoretical potential to either treat or cause autoimmune neuromuscular disorders by altering the complicated and delicate balances within the immune system networks. It is the most widely prescribed disease-modifying therapy for multiple sclerosis (MS). Large-scale clinical trials have established the clinical efficacy of IFN beta in reducing relapses and slowing disease progression in relapsing-remitting MS. IFN beta therapy was shown to be comparably beneficial for opticospinal MS (OSMS) and conventional MS in Japanese. IFN beta is effective in reducing relapses in secondary progressive MS and may have a modest effect in slowing disability progression. In addition to the common antiviral activity, IFN beta also induces increased production of the p53 gene product which promotes apoptosis, and thus has therapeutic effect against certain cancers. The role of IFN-beta in bone metabolism could warrant its systematic evaluation as a potential adjunct to therapeutic regimens of osteolytic diseases. Furthermore, IFN beta might play a beneficial role in the development of a chronic progressive CNS inflammation.

References

Kohriyama T, et al. (2008) Interferon-beta treatment for multiple sclerosis and predictors of response. Nippon Rinsho. 66(6): 1119-26.

Stbgen JP. (2009) Recombinant interferon-beta therapy and neuromuscular disorders. J Neuroimmunol. 212(1-2): 132-41.

Abraham AK, et al. (2009) Mechanisms of interferon-beta effects on bone homeostasis. Biochem Pharmacol. 77(12): 1757-62.

Catalog Number:MGE012-CY