Mouse ILKAP Gene ORF cDNA clone expression plasmid,N terminal GFP tag

Catalog Number:MGD965-NG

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1179bp
Gene Synonym
PP2C-DELTA, 0710007A14Rik, 1600009O09Rik
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse integrin-linked kinase-associated serine/threonine phosphatase 2C Gene ORF cDNA clone expression plasmid,N terminal GFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-GFPSpark
Restriction Site
Protein Tag
GFPSpark
Tag Sequence
GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
GFPSpark Tag Information
GFPSpark is an improved variant of the green fluorescent protein GFP. It possesses bright green fluorescence (excitation/ emission max = 487 / 508 nm) that is visible earlier than fluorescence of other green fluorescent proteins. GFPSpark is mainly intended for applications where fast appearance of bright fluorescence is crucial. It is specially recommended for cell and organelle labeling and tracking the promoter activity.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Integrin-linked kinase-associated serine/threonine phosphatase 2C, also known as ILKAP, is cytoplasm protein which belongs to the PP2C family. ILKAP contains one PP2C-like domain. ILKAP is widely expressed. Highest levels expressed in striated muscle. Much lower levels evident in various smooth muscle tissues. ILKAP may play a role in regulation of cell cycle progression via dephosphorylation of its substrates whose appropriate phosphorylation states might be crucial for cell proliferation. ILKAP selectively associates with integrin linked kinase (ILK), to modulate cell adhesion and growth factor signaling. ILKAP inhibits the ILK-GSK3B signaling axis and may play an important role in inhibiting oncogenic transformation. Integrin-linked kinase ( ILK ) plays key roles in a variety of cell functions, including cell proliferation, adhesion and migration. Within the cell, ILK localizes to multiple sites, including the cytoplasm, focal adhesion complexes that mediate cell adhesion to extracellular substrates, as well as cell-cell junctions in epidermal keratinocytes. Nuclear ILK can be rapidly exported into the cytoplasm through a CRM1-dependent pathway, and its export is enhanced by the type 2C protein phosphatase ILKAP. Nuclear localization of ILK in epidermal keratinocytes is associated with increased DNA synthesis, which is sensitive to inhibition by ILKAP.
References
  • Leung-Hagesteijn C. et al., 2001, EMBO J. 20: 2160-70.
  • Kumar,A.S. et al., 2004, Oncogene. 23 (19):3454-61.
  • Lammers,T. et al., 2007, Crit Rev Biochem Mol Biol. 42 (6):437-61.
  • Nakrieko,K.A. et al., 2008, Cell Cycle. 7 (14):2157-66.
  • TOP