Mouse ILKAP Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Mouse

NCBI Ref Seq

NM_023343.2

RefSeq ORF Size

1179bp

Gene Synonym

PP2C-DELTA, 0710007A14Rik, 1600009O09Rik

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse integrin-linked kinase-associated serine/threonine phosphatase 2C Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Integrin-linked kinase-associated serine/threonine phosphatase 2C, also known as ILKAP, is cytoplasm protein which belongs to the PP2C family. ILKAP contains one PP2C-like domain. ILKAP is widely expressed. Highest levels expressed in striated muscle. Much lower levels evident in various smooth muscle tissues. ILKAP may play a role in regulation of cell cycle progression via dephosphorylation of its substrates whose appropriate phosphorylation states might be crucial for cell proliferation. ILKAP selectively associates with integrin linked kinase (ILK), to modulate cell adhesion and growth factor signaling. ILKAP inhibits the ILK-GSK3B signaling axis and may play an important role in inhibiting oncogenic transformation. Integrin-linked kinase ( ILK ) plays key roles in a variety of cell functions, including cell proliferation, adhesion and migration. Within the cell, ILK localizes to multiple sites, including the cytoplasm, focal adhesion complexes that mediate cell adhesion to extracellular substrates, as well as cell-cell junctions in epidermal keratinocytes. Nuclear ILK can be rapidly exported into the cytoplasm through a CRM1-dependent pathway, and its export is enhanced by the type 2C protein phosphatase ILKAP. Nuclear localization of ILK in epidermal keratinocytes is associated with increased DNA synthesis, which is sensitive to inhibition by ILKAP.

References

Leung-Hagesteijn C. et al., 2001, EMBO J. 20: 2160-70.

Kumar,A.S. et al., 2004, Oncogene. 23 (19):3454-61.

Lammers,T. et al., 2007, Crit Rev Biochem Mol Biol. 42 (6):437-61.

Nakrieko,K.A. et al., 2008, Cell Cycle. 7 (14):2157-66.

Catalog Number:MGD965-CF