Mouse IL18BP / IL18BPa Gene ORF cDNA clone expression plasmid,N terminal HA tag

Gene

Species

Mouse

NCBI Ref Seq

NM_010531.1

RefSeq ORF Size

582bp

Gene Synonym

MC54L, Igifbp, IL-18BP

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse Interleukin 18 binding protein Gene ORF cDNA clone expression plasmid,N terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Interleukin-18-binding protein (IL-18BP) is a constitutively expressed and secreted protein. IL-18BP is a cytokine receptor that belongs to the interleukin 1 receptor family. This receptor specifically binds interleukin 18 (IL18), and is essential for IL18 mediated signal transduction. IFN-alpha and IL12 are reported to induce the expression of this receptor in NK and T cells. This gene along with four other members of the interleukin 1 receptor family, including IL1R2, IL1R1, ILRL2 (IL-1Rrp2), and IL1RL1 (T1/ST2), form a gene cluster on chromosome 2q. The adjacently located family members IL18 Receptor 1 (IL18R1) and IL18 receptor accessory protein (IL18RAP) may also be important in the development of asthma and atopy. IL-18 binding protein (IL-18BP) was only moderately elevated, resulting in a high level of biologically active free IL-18 in HPS. A severe IL-18/IL-18BP imbalance results in Th-1 lymphocyte and macrophage activation, which escapes control by NK-cell cytotoxicity and may allow for secondary HPS in patients with underlying diseases.

References

Novick D, et al.. (2001) A novel IL-18BP ELISA shows elevated serum IL-18BP in sepsis and extensive decrease of free IL-18. Cytokine. 14(6): 334-42.

Mazodier K, et al.. (2005) Severe imbalance of IL-18/IL-18BP in patients with secondary hemophagocytic syndrome. Blood. 106(10): 3483-9.

Akira S. (2000) The role of IL-18 in innate immunity. Curr Opin Immunol. 12(1): 59-63.

Catalog Number:MGD932-NY