Mouse IL18BP / IL18BPa Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:MGD932-NF

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
582bp
Gene Synonym
MC54L, Igifbp, IL-18BP
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse Interleukin 18 binding protein Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Interleukin-18-binding protein (IL-18BP) is a constitutively expressed and secreted protein. IL-18BP is a cytokine receptor that belongs to the interleukin 1 receptor family. This receptor specifically binds interleukin 18 (IL18), and is essential for IL18 mediated signal transduction. IFN-alpha and IL12 are reported to induce the expression of this receptor in NK and T cells. This gene along with four other members of the interleukin 1 receptor family, including IL1R2, IL1R1, ILRL2 (IL-1Rrp2), and IL1RL1 (T1/ST2), form a gene cluster on chromosome 2q. The adjacently located family members IL18 Receptor 1 (IL18R1) and IL18 receptor accessory protein (IL18RAP) may also be important in the development of asthma and atopy. IL-18 binding protein (IL-18BP) was only moderately elevated, resulting in a high level of biologically active free IL-18 in HPS. A severe IL-18/IL-18BP imbalance results in Th-1 lymphocyte and macrophage activation, which escapes control by NK-cell cytotoxicity and may allow for secondary HPS in patients with underlying diseases.
References
  • Novick D, et al.. (2001) A novel IL-18BP ELISA shows elevated serum IL-18BP in sepsis and extensive decrease of free IL-18. Cytokine. 14(6): 334-42.
  • Mazodier K, et al.. (2005) Severe imbalance of IL-18/IL-18BP in patients with secondary hemophagocytic syndrome. Blood. 106(10): 3483-9.
  • Akira S. (2000) The role of IL-18 in innate immunity. Curr Opin Immunol. 12(1): 59-63.
  • TOP