Mouse IL-1F5 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:MGD880-NY

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
468bp
Gene Synonym
IL-1H3, IL1HY1, AI413231, FIL1delta
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse interleukin 1 family, member 5 (delta) Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Interleukin-1 family member 5 (IL-1F5), also known as interleukin 36 receptor antagonist (IL36RA), is a member of the interleukin 1 cytokine family. This cytokine was shown to specifically inhibit the activation of NF-kappaB induced by interleukin 1 family, member 6 (IL1F6). IL-1F5 is a highly and a specific antagonist of the IL-1 receptor-related protein 2-mediated response to interleukin 1 family member 9 (IL1F9). IL-1F5 could constitute part of an independent signaling system analogous to interleukin-1 alpha (IL-1A), beta (IL-1B) receptor agonist and interleukin-1 receptor type I (IL-1R1), which is present in epithelial barriers and takes part in local inflammatory response. It has been proved that IL-1F5 induces IL-4 mRNA and protein expression in glia in vitro and enhances hippocampal expression of IL-4 following intracerebroventricular injection. The inhibitory effect of IL-1F5 on LPS-induced IL-1β is attenuated in cells from IL-4-defective mice. Experiment results suggest that IL-1F5 mediates anti-inflammatory effects through its ability to induce IL-4 production and that this is a consequence of its interaction with the orphan receptor, single Ig IL-1R-related molecule (SIGIRR)/TIR8, as the effects were not observed in SIGIRR−/− mice. In contrast to its effects in brain tissue, IL-1F5 did not attenuate LPS-induced changes, or up-regulated IL-4 in macrophages or dendritic cells, suggesting that the effect is confined to the brain.
References
  • Nicklin MJ, et al. (1994) A physical map of the region encompassing the human interleukin-1 alpha, interleukin-1 beta, and interleukin-1 receptor antagonist genes. Genomics. 19 (2): 382-4.
  • Debets R, et al. (2001) Two novel IL-1 family members, IL-1 delta and IL-1 epsilon, function as an antagonist and agonist of NF-kappa B activation through the orphan IL-1 receptor-related protein 2. J Immunol. 167 (3): 1440-6.
  • Costelloe C, et al. (2008) IL-1F5 mediates anti-inflammatory activity in the brain through induction of IL-4 following interaction with SIGIRR/TIR8. J Neurochem. 105(5): 1960-9.
  • TOP