Mouse IL-1F5 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Mouse

NCBI Ref Seq

NM_019451.1

RefSeq ORF Size

468bp

Gene Synonym

IL-1H3, IL1HY1, AI413231, FIL1delta

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse interleukin 1 family, member 5 (delta) Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Interleukin-1 family member 5 (IL-1F5), also known as interleukin 36 receptor antagonist (IL36RA), is a member of the interleukin 1 cytokine family. This cytokine was shown to specifically inhibit the activation of NF-kappaB induced by interleukin 1 family, member 6 (IL1F6). IL-1F5 is a highly and a specific antagonist of the IL-1 receptor-related protein 2-mediated response to interleukin 1 family member 9 (IL1F9). IL-1F5 could constitute part of an independent signaling system analogous to interleukin-1 alpha (IL-1A), beta (IL-1B) receptor agonist and interleukin-1 receptor type I (IL-1R1), which is present in epithelial barriers and takes part in local inflammatory response. It has been proved that IL-1F5 induces IL-4 mRNA and protein expression in glia in vitro and enhances hippocampal expression of IL-4 following intracerebroventricular injection. The inhibitory effect of IL-1F5 on LPS-induced IL-1β is attenuated in cells from IL-4-defective mice. Experiment results suggest that IL-1F5 mediates anti-inflammatory effects through its ability to induce IL-4 production and that this is a consequence of its interaction with the orphan receptor, single Ig IL-1R-related molecule (SIGIRR)/TIR8, as the effects were not observed in SIGIRR−/− mice. In contrast to its effects in brain tissue, IL-1F5 did not attenuate LPS-induced changes, or up-regulated IL-4 in macrophages or dendritic cells, suggesting that the effect is confined to the brain.

References

Nicklin MJ, et al. (1994) A physical map of the region encompassing the human interleukin-1 alpha, interleukin-1 beta, and interleukin-1 receptor antagonist genes. Genomics. 19 (2): 382-4.

Debets R, et al. (2001) Two novel IL-1 family members, IL-1 delta and IL-1 epsilon, function as an antagonist and agonist of NF-kappa B activation through the orphan IL-1 receptor-related protein 2. J Immunol. 167 (3): 1440-6.

Costelloe C, et al. (2008) IL-1F5 mediates anti-inflammatory activity in the brain through induction of IL-4 following interaction with SIGIRR/TIR8. J Neurochem. 105(5): 1960-9.

Catalog Number:MGD880-CM